Parent Directory | Revision Log
and examples
1 | #!/usr/bin/perl -w |
2 | # Transcribing DNA into RNA |
3 | |
4 | # The DNA |
5 | $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; |
6 | |
7 | # Print the DNA onto the screen |
8 | print "Here is the starting DNA:\n\n"; |
9 | |
10 | print "$DNA\n\n"; |
11 | |
12 | # Transcribe the DNA to RNA by substituting all T's with U's. |
13 | $RNA = $DNA; |
14 | |
15 | $RNA =~ s/T/U/g; |
16 | |
17 | # Print the RNA onto the screen |
18 | print "Here is the result of transcribing the DNA to RNA:\n\n"; |
19 | |
20 | print "$RNA\n"; |
21 | |
22 | # Exit the program. |
23 | exit; |
Name | Value |
---|---|
svn:executable | * |
ViewVC Help | |
Powered by ViewVC 1.1.26 |